So wait, hold up. What’s happening?? A coronavirus VARIANT? Now? When people are starting to get (appallingly slowly) vaccinated? Now that we have the vaccine the virus flips the script and switches up to a different version of itself?
More than likely, this has prompted some of you to ask two, possibly three questions:
- How did this happen?
- Is the vaccine effective against the new virus?
- What does this do for social distancing/mask wearing?
Fair enough. Let’s try and tackle this first question and try not to get overly technical with it. The answer, I’m afraid, is somewhat technical. But keep reading and feel free to share if you like.
Question #1: How do coronavirus variants form?
SARS-CoV-2 has made different versions of itself because it’s an RNA virus. See, here’s the thing…Viruses have (basically) two different versions of their genetic material; some have their genomes made up of RNA, some have them made up of DNA.
You, of course, have all your genes and chromosomes tied up in the DNA system. You are Team DNA. The master copies of everything that makes you you, is all coded in wicked-smaht Deoxyribonucleic Acid. It’s just as Watson and Crick wrote up in 1953—your genes are all wrapped up in a double helix structured DNA. And for this, you should be very, very happy because that’s the way you really want it.
See, here’s the thing about DNA: when DNA needs to copy itself, it’s reeeeeeeallly good at copying itself without making any errors. If you wanted to play a game, read the following series of letters and then close your eyes and try and repeat them exactly as you read them:
ACCTTGGACTCACGGTTCACTGGTTCCAATCTGA
How did you do? That was 34 letters you had to memorize and repeat. One error in repeating them could have led to a mutation. Mutations when you copy your genetic code could lead to the ability to create magnetic fields or shape-shifting or telekinesis but what would be more likely than a fun X-Men reference would be something worse, like cancer.
Now, in fairness to mutations, they resulted in slight changes in our genetic code and this how we evolved as a species. The word “mutation” has such negative connotations and that’s unfortunate. These changes allowed people exposed to more sun to handle it by adding more melanin in their skin. Likewise, those exposed to less sun at higher latitudes will have less melanin in their skin. A theory on why this happened is that the nutrient folate degrades with increased sun exposure and folate deficiencies can lead to fatal birth defects (hence why prenatal vitamins contain folate) as well as decreased sperm motility. In both cases, this leads to lack of healthy births. So, if you live at more equatorial latitudes and are exposed to more sun, you need more melanin to reduce the photo-degradation of folate so you can reproduce more effectively. And this is why we have varying shades of skin color which, sadly, has caused a much different reaction in our society than simply appreciating the reason it exists which was simply so that people living in certain parts of the world could have healthy babies.
But I digress. Sorry. What does this have to do with viruses?
DNA vs. RNA copies
Well, when your DNA copies itself, it makes roughly one error per 10,000,000-1,000,000,000 letters they have to copy. Guys, that’s really, really, REALLY good. How many errors did you make when you had to repeat 34 letters?
Some viruses use DNA as their genome and have effectively the same error rate when they copy themselves. A good example of this is the smallpox virus. If you didn’t read that post, smallpox was, again, the worst infectious disease that humans have ever tangled with. Its easy transmissibility combined with its absolutely terrifying case fatality rate gave it the title of “MHOAT” (Most Horrifying of All Time)–I just made that term up.
Fortunately for humanity, smallpox is a pox virus which is a family of viruses which uses DNA as its genome. Because of this, the smallpox genome has remained relatively stable over the past 1000 years. If you’re of a certain age, you got a smallpox vaccine and that smallpox vaccine would have been just as good in 1560 as it was in 1960.
However, RNA viruses—like coronaviruses—don’t work like that.
When RNA viruses replicate themselves, they have to use something called RNA polymerase (DNA viruses use something called DNA polymerase). Well, RNA polymerase makes an error at the rate of 1 in 1,000-100,000. That’s, well, that’s a lot of messing up.
All those mess-ups lead to mutations. All those mutations lead to new variants. Now this is very important so pay very close attention: The more the virus spreads, the more it replicates. The more it replicates, the more it mutates. And the more variants we get.
So, what of these variants? Are they more deadly? As of now, that’s not clear. Are they more contagious? Yeah, apparently. And the more easily they spread, the more easily they mutate. Remember, each time a new person gets it, the virus is replicating itself and screwing up the genome a little bit more. That exponential growth of cases in the US? That’ll also mirror the emergence of new variants here.
So, Question #2: Will the vaccine help with new variants?
We certainly hope they will (fingers crossed emoji).
Yeah, I know, that’s not very inspiring but quite honestly nobody knows. In theory, the vaccine should help with the new variants because the vaccine doesn’t work by targeting the virus’ protein coat, which changes quite regularly with mutations; rather it targets something called a spike protein, which is something that SARS-CoV-2 and its variants should all have.
So, it SHOULD work. But will it? Nobody really knows yet. I sure hope that in June, July, and August we all see that the vaccine seems to confer resistance to the variants, but nobody knows for sure and if anybody tells you they know for sure, beyond a shadow of a doubt, you should be very, very skeptical.
Question #3: are masks and social distancing still necessary?
What about the mask wearing/social distancing? You should still do it. Why? Well for one thing, the vaccine rollout has been far too slow. At our current pace, the country won’t be vaccinated until Thanksgiving (not the next one in 10 months, the one in 23 months). So, there are plenty of people who haven’t gotten their shots yet and that’s not changing.
More than that, even if you have gotten the shot, we still have no firm idea if A) you can be overly affected by one of the new variants or B) if you can still transmit one of the new variants (or the original) to people who haven’t yet gotten the shot. Why, by the way, do you think you have to get a different flu shot every year? *whispers* Because influenza is also an RNA virus and it mutates all the time!
I’m acutely aware that people are sick of this new normal and I get it. I hate Zoom. IhateitIhateitIhateitIhateit. EVERY TIME somebody suggests a Zoom meeting I want to throw my computer at a wall. I’m sick of wearing masks (other than my DOPE Optimus Prime Mask, which I know everybody is hugely jealous of every I walk in a store. Stores are going to have to open again and I very much get that too. Many people can’t take another 2020, financially. So we do have to get back to life BC (before COVID).
Guess what? If you want this thing to stop, you still have to wear the masks and socially distance as best you can. The more people get it, the more the virus replicates. The more it replicates, the more it mutates. The more it mutates, the longer this goes.
The more things change, the more this all stays the same.
The expert family medicine providers at the Des Moines University Clinic are here to help you and your loved ones stay healthy year-round. If you think you or your family have been infected with COVID-19 and live in Polk County, call 2-1-1. If you have an upcoming appointment at the DMU Clinic please call in advance. More information is available on DMU’s coronavirus response website.
